Biostar

15,707 results • Page 1 of 315

fundamental concepts of Hi-C sequencing and its significance in genome curation. From understanding assembly quality metrics to identifying sex chromosomes, we'll cover everything you need to deliver high-quality chromosome...assemblies. ---------- **TARGETED AUDIENCE & ASSUMED BACKGROUND:** Ideal for biologists and bioinformaticians, this course blends lectures...and hands-o…

GenomeAssembly PretextView Manual-Genome-Curation

updated 5 hours ago • carlopecoraro2

Hello! I need to calculate the OS of two types of cancer: CESC and HNSC. I will search the relation between the OS and gene expression. But I didn

overall-survival

updated 7 hours ago • Pedro

the type of reads is DNA. I know that first I need to do pre-processing analysis and then genome assembly and generate consensus, for last two steps I don't have much information about the tools that will give me good results...I need suggestions from others who have worked in this scope before on the tools I can use for assembly and to construct final consensus sequence genome

mammals mitochondrial-genome

updated 7 hours ago • m90

I have a list of regions for different genes. I want to know how much of overlapping is there in terms of basepairs with corresponding genes (Exons). I want to do it in R. How to do it?

genomics

updated 7 hours ago • Xbox_27

index.hbi?lang=en there is: ``` >>> 279332 $1 Taxon : Homo sapiens $2 Assembly : hg38 $3 Chr : chr10 $4 Symbol : CREM $5 GeneID : 1390 $6 GenBankID : $7 SymbolAliases : CREM-2; ICER; hCREM-2 $8 GeneNames : cAMP responsive

UTR masspec uORF peptide

updated 10 hours ago • Pierre Lindenbaum

A huge advantage of long-read sequencing compared to traditional short-read methods is its ability to sequence complex repetitive regions of the genome, such as GC-rich areas or those of high homology, regions often associated with disease-causing variants. PacBio’s HiFi sequencing, with read lengths of 15-20kb, has gained attention for its ability to provide accurate and comprehensive genomic in…

LRS

updated 14 hours ago • Novogene

C DP FDP SDP SUBDP AU CU GU TU 153 0 0 0 0,0 77,79 0,0 76,76 How can I calculate the allele frequency from this information? I don't quite understand why in the first case there is nothing on AU

VEP variant

updated 1 day ago • ramiro.barrantes

Mean Insert Size, # SNPs, # Filtered SNPs, # SNPs after BQSR, # Filtered SNPs after BQSR, Average Coverage 2. Annotated SNP and Predicted Effects in a .html and .txt file. **In the text file** was #GeneName, GeneId, TranscriptId BioType

GATK pipeline figures DNA-seq

updated 1 day ago • mgranada3

c(NA, -18L)) **Based on this data, I produced a PCA plot.** **Then I want to know if I can calculate the donor effect (A~L) and group effect(a~f) that contribute the PCA result, especially dim PC1 and dim PC2?** **So I can say...But the donor effect also exist.** If there are any better methods to be used to do similar calculation? I hope you can give me some adivce on this question. T…

PCA R VARIANCE

updated 1 day ago • diqixiaoyaoer

58617616,assembly=38> ##contig=<id=chr20,length=64444167,assembly=38> ##contig=<id=chr21,length=46709983,assembly=38> ##contig=<id=chr22,length...50818468,assembly=38> ##contig=<id=chrx,length=156040895,assembly=38> ##contig=<id=chry,length=57227415,assembly=38> ##contig=<id=chrm,length...per_gene Why is this happening? Thank…

annotation vcf vep zygosity deepvariant

updated 1 day ago • asalimih

Hi Community, I have to calculate the read depth of HG002 UCSC Nanopore Sequencing data for my benchmarking. I downloaded 3 fastq files provided...minimap2. ``` minimap2 -ax map-ont --secondary=no --MD ``` ChatGPT gives me following cmd to calculate: ``` sequencing_depth=$(samtools depth -a "$sorted_bam_file" | awk '{sum += $3} END {print sum/NR}') echo "Sequencing Depth: $sequen…

depth

updated 1 day ago • jiahangkui1234

I have 12 different RNA-seq metatranscriptome samples that I am trying to assemble using Trinity, but my computer (and Galaxy) cannot handle the size of the samples. The sample list is as follows: Microbe...this causes my computer to run out of storage and memory. For my purposes, would it be okay to assemble each of the 12 samples one at a time? Alternatively, what if I did 2 assembly runs, wit…

trinity metatranscriptome

updated 1 day ago • jway

I'm new to bioinformatics so I apologize in advance. I have a pipeline for genome assembly, the output I get is a de novo assembly file SPAdes, contigs.fasta, as well as a variant file vcf.fasta, I need to use the

finishing genome

updated 1 day ago • trezini

Hi all, I have a plot that pretty much gives me everything I want in terms of aesthetics (except the 'Not assigned' category should be shown in grey in the legend, but I never got that snippet of code to work... oh well...). Here is my code: Picornas_for_interactive_graph3 <- ggplot(justPicorna_contiginfo, aes(x = kmer_cov, y = percid, size = querylength, color = family, text = subjec…

ggplot ggplotly

updated 2 days ago • jen

c. 400-1000) using plink and imputed using the Michigan Imputation Server using TOPMED on the hg38 assembly. However, these datasets now have 40million+ sites, and I was wondering what, if any post-imputation QCs I can do to possibly...this, is there any other way I could reduce the number of sites I'm looking at to speed up the calculation

gwas prs

updated 2 days ago • graeme.thorn

the ceRNA genes for the miRNA family miR-10-5p : curl 'https://rnasysu.com/encori/api/ceRNA/?assembly=hg38&geneType=mRNA&ceRNA=all&miRNAnum=2&family=miR-10-5p&pval=0.01&fdr=0.01&pancancerNum...EOF"`. Following is an example of such a case: curl 'https://rnasysu.com/encori/api/ceRNA/?assembly=hg38&geneType=mRNA&ceRNA…

ceRNA ENCORI WebAPI microRNA starBase

updated 2 days ago • Bhavya

If I want to see if my transcription factor chipseq correlate with a histone mark chipseq, is this a common practise: bamcompare to get the bigwig file with fold enrichment and then use bigwigsummary and plotcorrelation? But this method gave me very low correlation coefficient, even the histone mark showed more than 40% of overlapping peaks with my called peaks and showed similar pattern in IGV…

chipseq bigwigsummary deeptools correlation

updated 2 days ago • Emily

differentially expressed genes (DEGs), I'm uncertain whether I should apply the same filter to calculate the total expressed genes. total <- total[total$logCPM > 1, ] Alternatively, some discussions suggest considering

RNA-SEQ

updated 2 days ago • Pegasus

XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:36 YS:i:0 YT:Z:DP ``` I want to see gene specific coverage from the bam file. The result should have the gene_name in 1st column and its Coverage in 2nd column I tried this command...8].split(';')[3].split('"')[1] gene_info[gene_id] = gene_name return gene_info # Calculate gene-specific coverage from the BAM file def calculate_g…

WGS SARS-CoV2

updated 3 days ago • Adyasha

longer contiguous stretch of sequence (or "contig"). ``` TGCATGATGG ATGCGCTGC ATGATGGATACCCC ``` Assemble them into the original contig My answer: ATGCGCTGCATGATGGATACCCC (Original Contig) **Question 2** These additional...from a larger contig that incorporates the original contig. ``` GGTCGCTTCGCGGCC GCGGCCGCTAATCGGGG ``` Assemble them into the larger sequence. My answer: …

dna genetics contig assembly

updated 3 days ago • samRayne

Hi ! I wonder, do you have a favorite tool to check the quality of an assembly ? I am interested in knowing if there are some real issues (such as chimeric contigs that I should break). The problem

assembly

updated 3 days ago • lagartija

I am seeking help with Augustus gene prediction! I am performing a whole genome assembly of a plant species. I have completed the gene prediction using the Augustus pipeline. The output file is of format

augustus annotation assembly genome

updated 3 days ago • Vijith

longer contiguous stretch of sequence (or "contig") TGCATGATGG ATGCGCTGC ATGATGGATACCCC Assemble them into the original contig. Worked this part out (my alignment for genome assembly) ...............TGCATGATGG ATGCGCTGC .......................ATGATGGATACCCC...the correct order to reconstruct the original sequence. In contrast, question 9.2 involves assembling additional…

sequence university assembly protein genomics

updated 4 days ago • rackbersingh

will explore everything from data QC and gene expression quantification to transcriptome assembly and RNA modification detection. **Target Audience and Assumed Background:** This course is tailored for researchers

Nanopore RNAseq

updated 4 days ago • carlopecoraro2

DNA sequences have all been derived from the same longer contiguous stretch of sequence (or "contig").** **Assemble them into the original contig.** Worked this part out (my alignment for genome assembly) ``` ...............TGCATGATGG ATGCGCTGC .......................ATGATGGATACCCC...is there which results in the sequence: `GGTCGCTTC**GCGGCC**GCTAATCGGGG` This then leads onto the assembly of …

sequence-analysis protein-synthesis

updated 6 days ago • rackbersingh

Hi, I'm trying to use PRS-CSx which requires SNP, A1, A2, Beta/OR and P value/SE. I want to use the individual study beta's instead of the random/fixed effect. Is there a way to calculate the p value/se for the individual study betas from this information? Columns in the file: CHR Chromosome code BP Basepair...SE. I want to use the individual study beta's instead of the random/fixed ef…

prscsx beta se pvalue

updated 6 days ago • curious_butterfly

Hi guys! I'm writing an article about de-novo assembling of eykariotic genomes of non-model organisms. I didn't find a guide for researchers how to sequence such sample...Do we have to first separate nuclear from mito genomes to make assemblies better? And then process them separately. I would be grateful for any link or comment. Have a great day

de-novo WGS DNA-seq assembling

updated 7 days ago • Matvii Mykhailichenko

on Hi-C scaffolding**. I have a set of scaffolds which were produced following the VGP genome assembly pipeline (HiFi data from a single individual, pooled Hi-C data, no Bionano data) (https://doi.org/10.1038/s41587-023-02100...bin. Any idea what might be causing this? I feel I must have made an error somewhere upstream in the assembly, but it's possible there are additional steps I need to take …

BWA-MEM2 Hi-C PretextMap

updated 7 days ago • Winter

file using ensembl vep and gnomad v4 vcf file: vep --cache --offline --species homo_sapiens --assembly GRCh38 \ --input_file input.vcf \ --custom gnomad.vcf.bgz,gnomADg,vcf,exact,0,AF because the `gnomad.vcf.bgz` file contains

vep vcf gnomad

updated 8 days ago • asalimih

to Bacillus paranthracis, which was identified using rMLST, TYGS, and BLAST analysis. The genome assembly file was then provided to the KEGG-KASS tool. Although the prokaryotic dataset was selected for analysis, the identified...KO) as extracted from KEGG-KASS or by exploring alternative methods to utilize bacterial genome assembly or protein sequences for pathway identification. Please suggest a…

KEGG-KASS WGS Pathway denovo

updated 8 days ago • mathavanbioinfo

Hello everyone, I'm currently working with VCF files of mutations from the TCGA dataset using the hg38 assembly. To further my analysis, I'm interested in comparing mutation rates with the methylation status for each cancer type...everyone, I'm currently working with VCF files of mutations from the TCGA dataset using the hg38 assembly. To further my analysis, I'm interested in…

TCGA hg38 methylation Illumina

updated 8 days ago • elisheva

description below: File 1: WGS Illumina paired-end reads for a single plant sample that I have assembled using megahit, resulting in a FASTA file of contigs. This will act as my "reference genome". File 2: FASTA file of contigs...generated from de novo assembly of ddRADseq reads for several hundred samples. This will act as my "query" All I want to do is align my de novo assembly...to m…

SAMtools BWA alignment ddRAD

updated 8 days ago • Lemonhope

At a glance: Overview The First Essentially Complete Sequence of The Human Genome The First Complete Sequence of The Human Genome Future Research Overview The human genome, the genetic code that makes us uniquely human, has been the subject of scientific study and fascination for decades. The human genome contains approximately 3.055 billion base pairs. These are the molecular building bl…

biotech

updated 8 days ago • usa.cd.genomics

Hi all, I am working on a new reference genome and I would like to draw a gene density plot, to visualize the amount of genes per chromosome. I already did the coverage and GC plot, calculating these two values in 100kb sliding windows. However, I am not finding the way of doing that with...like to draw a gene density plot, to visualize the amount of genes per chromosome. I already did the cov…

density gene

updated 9 days ago • gubrins

of NGS applications (e.g. RNA-seq, DNA SNP and structural variant detection, de novo sequence assembly, etc.). While candidates ideally will have experience in more than one type of bioinformatics analysis, candidates

job

updated 9 days ago • toddknutson

is my first experience working with miRNA data, I am not sure if everything is correctly implemented. ``` # Calculate TPM for RNA-seq data having a vector of gene lengths x <- RNA_counts/geneLength norm_RNA_counts <- t(t(x) * 1e6 / colSums...x)) # Calculate TPM for miRNA-seq data library_sizes_miRNA <- colSums(miRNA_counts) scaling_factors_miRNA <- median(library_siz…

TCGA normalization TPM miRNA

updated 10 days ago • Ngrin

pipeline against version 5 of the B73 reference genome. The output was filtered for mapping quality, coverage, and linkage disequilibrium, and annotated based on variant effects relative to the B73 RefGen_v5 gene annotations

herald

updated 10 days ago • Biostar

SNPs one by one. For example, I could add associated variants to the vcf file, use vcftools to calculate r2 in the neighborhood around each associated variant, and form a list of associated background variants to remove

snp vcf plink filtering independent

updated 10 days ago • Jautis

I am new in this field. I am doing complete assembly from Illumina paired-end sequencing. I have nuclear sequencing .fastq (R1 and R2) files from which I mapped with mitochondria...I am new in this field. I am doing complete assembly from Illumina paired-end sequencing. I have nuclear sequencing .fastq (R1 and R2) files from which I mapped with mitochondria reference genome and extract the mitoch…

gapclosure Mitogenomes validation circulargenome

updated 11 days ago • KHURRAM SHAHZAD

will learn about Trasposable Elements (TE) biology, computational analyses of TEs in genome assemblies and raw read data (building de-novo TE library, TE quantification, Insertion polymorphism) as well as transcriptomics

GenomeAssembly Transcriptomics TransposableElements ManualCuration

updated 11 days ago • carlopecoraro2

to StringTie's manual: "If the -G option (reference annotation) is provided, StringTie will assemble the transfrags from the input GTF files with the reference transcripts" - my assumption was that it would somehow

stringtie stringtie-merge

updated 11 days ago • DGTool

it from exon only data? Are there any specific factors to consider? Additionally, is there a way to calculate the percentage of intronic reads for each cell?If a cluster has a high percentage of intronic reads, can it be considered

single-cell

updated 12 days ago • carolofharvest

0, "Positive", "Negative") # Set expansion factor for x-axis limits x_expand <- 0.1 # Calculate the position for text labels data$text_pos <- ifelse(data$NES > 0, data$NES + 0.5, data$NES - 0.5) # Plot with modified order

barplot RNA-seq GSEA enrichment

updated 12 days ago • Rob

I request you for small help with Augustus gene prediction tool. I am using Augustus for annotation of a *de novo* assembled genome of a plant species. Reading the Augustus documentation, I see a list of plant species. These model plants and...for small help with Augustus gene prediction tool. I am using Augustus for annotation of a *de novo* assembled genome of a plant species. Reading the A…

augustus annotation assembly genome

updated 13 days ago • Vijith

I've successfully completed the identification and masking of TE elements in the assembled genome output. I used RepeatMasker for this purpose. This process looked as follows, on the terminal window: identifying

sequence annotation repeatmasker illumina assembly

updated 14 days ago • Vijith

with the aim to find potential differences in the profiles among strains of different origin. The assemblies are of very similar quality and the analysis pipeline was identical. Surprisingly I am seeing more than 2x differences...the most prevalent terms and I am not sure how to explain these differences given that they are all assemblies of the same species? I am considering relativizing…

GO ontology

updated 15 days ago • taavi.riit

of 193 bacterial plasmids (from a total of 39 isolates from the same bacterial species) using hybrid assembly (Illumina and MinION technologies). Some bacterial isolates contain multiple plasmids ranging from 3-8 in total

bacteria plasmid wgs hybridassembly sequencing

updated 15 days ago • nicole.kavanagh

is ion torrent(ionxpress), now can anyone tell me the tools to circularise the ion torrent genome assembly , cause circlator mentions only pacbio and nanopore data

iontorrent bacteria circularise

updated 15 days ago • VITALA

In HUMAnN, it calculates the coverage of pathways from translated searching reads against a diamond database and then using MinPath...In HUMAnN, it calculates the coverage of pathways from translated searching reads against a diamond database and then using MinPath. In KEGG Maple (discontinued) and MicrobeAnnotator, it looks at KEGG Orthology then determines the completion for different KEGG m…

metagenomics metacyc enzyme pathway genomics

updated 15 days ago • O.rka

Hi all, I'm trying to calculate adjusted pvalue in R. Let's say I have pvalues of spearman correlation from 5 genes and 2 metabolites (10 tests were...Gene3 0.511551 0.9262647 Gene4 0.6669462 0.4057542 Gene5 0.4910232 0.3086241 ``` Now, I want to calculate adjusted pvalue using FDR correction. Here is the approach I tried: 1. `p.adjust(pval_matrix, method='fdr', n=10)` 2. `p.adjust

statistics R p-value

updated 16 days ago • Jonathan Yoou

15,707 results • Page 1 of 315

Recent Votes

ATAC-seq sample normalization

Answer: Faster Needleman-Wunsch rapid global alignment of two sequences?

Comment: Faster Needleman-Wunsch rapid global alignment of two sequences?

Comment: Can I perform a correlation test with 3 biological replicates per condition?

Answer: --normalizeUsing RPGC

Answer: Details on salmon index

Recent Locations • All